BBa_M33033 1 BBa_M33033 NarL: regulates nitrate reduction (weak RBS) 2010-06-01T11:00:00Z 2015-05-08T01:14:01Z consult BBa_M33033 The two Ecoli K-12 cell membrane proteins, NarX and NarQ, are responsive to nitrate and nitrate in the environment. When nitrate levels increase, When NarX (a membrane protein) binds nitrate, it autophosphorylates and then acts as a histidine kinase on the NarL protein. When NarL is phosphorylated, it binds bacterial DNA and acts as a repressor/activator, depending on the particular operon.they transfer a signal to the NarL gene. The NarL protein is a cytoplasmic transcription factor that serves as the second component in the two-component Nar pathway. When NarL is phosphorylated, it binds bacterial DNA and acts as a repressor/activator, depending on the particular operon. With increased nitrate, NarL upregulates the expression of three nitrate reducing enzymes, nitrate reductase (narGHJI), dimethyl sulfoxide/trimethylamine-N-oxide reductase (dmsABC), and fumarate reductase (frdABCD). Therefore, expression of NarL appears to be directly correlated to the presence of nitrate in the system, and could potentially be used with Bba_216005, a nitrate sensitive promotor, and a color generator in a novel nitrate sensing construct. For this part, we have added BBa_J23106, a medium strength constitutive promoter, and moderate strength RBS Bba_B0030. false false _577_ 0 6931 9 Not in stock false consult BBa_M33033 false Scott Runyon annotation2069981 1 J23106 range2069981 1 1 35 annotation2069982 1 B0033 range2069982 1 36 46 annotation2069983 1 NarL range2069983 1 53 703 BBa_M33033_sequence 1 tttacggctagctcagtcctaggtatagtgctagctcacacaggactactagatgagtaatcaggaaccggctactatcctgctgattgacgatcacccgatgctgcgaactggcgtaaaacagcttatcagtatggcaccagatatcaccgtggttggcgaagcgagtaatggcgaacagggtattgaactggcggagtctcttgatcccgatctgatcctgttagatctcaatatgcccggcatgaacggtctggaaacgctggataaactgcgcgaaaagtccctctcagggcgcattgtggtattcagcgtctctaaccatgaagaagatgtggtcaccgcactgaaacgcggcgcggatggctatctgttaaaagatatggaaccggaagatctgctgaaagcattgcatcaggcagctgctggcgaaatggtattaagcgaagcattaacgcctgttctggccgccagcttgcgcgctaaccgtgccactactgagcgcgatgttaaccagttaaccccacgcgagcgcgatattctcaagctgattgcccagggtttgccgaacaagatgattgcccgccgcctggatatcaccgaaagcacagtaaaagtgcacgtcaagcacatgctgaagaaaatgaagctcaagtctcgcgtggaagcagcggtatgggtgcatcaggagcgcattttctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z