BBa_M33332 1 BBa_M33332 glnK CDS 2010-05-31T11:00:00Z 2015-05-08T01:14:01Z From Pseudomonas putida KT2440 at http://www.ncbi.nlm.nih.gov/nuccore/NC_009512, bp 5967730..5968070. Found via a BLAST search from annotated glnK sequence in Pseudomonas aeruginosa PA7 at http://www.ncbi.nlm.nih.gov/gene/5355431 Pseudomonas sp. ADP digests atrazine under nitrogen starvation conditions. atzABC are constitutively expressed and convert atrazine to cyanuric acid. atzDEF convert cyanuric acid to carbon dioxide and ammonia, which the cell digests. The atzDEF operon is regulated by atzR, a protein that autoregulates its production in the same region. GlnK is produced under nitrogen limitation conditions and induces expression of atzDEF. GlnK is a nitrogen regulatory protein that is needed for forcing the system to exhibit a nitrogen-limited scenario. GlnK protein is a member of the trimeric PII signal transduction protein family. GlnK aids in the expression of atzR by demonstrating nitrogen limitation. This part should be used in conjunction with BBa_M33333, the atzDEF operator region. See related parts BBa_M33330 and BBa_M33333. false false _577_ 0 6930 9 Not in stock false None false Frank Li BBa_M33332_sequence 1 atgaagctagtcacagccatcatcaagccgttcaagctggacgacgtgcgcgagtcgctgtcggaaatcggcgtgcagggcatcaccgtcaccgaagtcaaaggtttcggtcggcagaagggccacaccgagctgtatcgcggtgctgaatatgtggtcgatttcctgcccaaggtgaagatcgatgtcgccatcgatgacaaagaccttgatcgggtaatcgaagccatcaccaaggcagccaacaccggcaagatcggtgacggcaagattttcgtggtgaatctggagcaggcgatccgcatccgtaccggcgaaaccgataccgacgcgatctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z