BBa_M33333 1 BBa_M33333 atzDEF/atzR operator 2010-05-31T11:00:00Z 2015-05-08T01:14:01Z From Psuedomonas sp. ADP at http://www.ncbi.nlm.nih.gov/nuccore/13937422, bp 100851..100946 Pseudomonas sp. ADP digests atrazine under nitrogen starvation conditions. atzABC are constitutively expressed and convert atrazine to cyanuric acid. atzDEF convert cyanuric acid to carbon dioxide and ammonia, which the cell digests. The atzDEF operon is regulated by atzR, a protein that autoregulates its production in the same region. GlnK is produced under nitrogen limitation conditions and induces expression of atzDEF. This operator region has a leftward-facing repressible promoter and a rightward-facing activated promoter. AtzR remains bound to the DNA. In the natural system, the left-facing promoter is upstream of the atzR CDS, and atzR is autoregulatory; in the presence of cyanuric acid, the binding of AtzR changes to cause the right-facing promoter to become activated, allowing for the expression of the downstream atzDEF CDS. The presence of cyanuric acid "frees" AtzR from being bound to the atzDEF promoter so polymerase can now bind and transcribe following gene. AtzR remains bound to the atzR promoter region even in the presence of cyanuric acid. Note that high glnK concentrations are also needed, as glnK is a co-activator of downstream operator. This part should be used in conjunction with BBa_M33330, the atzR CDS. See related parts BBa_M33330, BBa_M33331, and BBa_M33332. false false _577_ 0 6930 9 Not in stock false None false Frank Li BBa_M33333_sequence 1 catgcgagtcaaagcaagatcggtgccggatcggcaccagttaggtcggaaaaaggcggcagtcaagtgcgcagggcggcgttaagcttgaacgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z