BBa_M33335 1 BBa_M33335 CDS for Inorganic mercury-sensitive regulatory protein merR coding sequence with RBS 2010-06-04T11:00:00Z 2015-05-08T01:14:01Z Thermus thermophilus HB27, complete genome GenBank: AE017221.1 773178..773606 This contains the coding sequence for merR (mercury repressor protein) with an added medium strength RBS. It is part of the mer operon from Thermus thermophilus HB27, and binds to the mer promoter in the absence of inorganic mercury. if inorganic mercury is present, it binds to merR, which undergoes a conformational change that allows for transcription of the downstream operon. false false _577_ 0 6927 9 Not in stock false We had to add a medium strength RBS (AAAGAGGAGAAA) false Christopher Brunson BBa_M33335_sequence 1 attaaagaggagaaatactagatgccctacaccatcggcgagctcgcccgggcgtttggcctttctcctgatgccctccgctactacgaaaggcttgggctcctcgcccccagcggccgttcgcccgggggggttcgcctctacggggaggaggccttccgccgcctccgcttcatcaaggaggcccaggcggcggggcttaagcttgaggacatcgcctggatcctccgcgccgtggaggagggccatcccccctgccgccacgtgcgggaggccctggccaagcgcctggcggaggtgcggcgtaggctcagggagctccaggccctggaagcggccctggccgaacggctggcctacgccgaggcccaccctgaccctgcttgcgacgggcgggaccgctgcgtctatttggacccccttgaccctggagcacgctccagggtctagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z