BBa_M33336 1 BBa_M33336 Inorganic Mercury-Inducible Promoter repressed by merR 2010-06-04T11:00:00Z 2015-05-08T01:14:01Z Thermus thermophilus HB27, complete genome GenBank: AE017221.1 774845-77505 This operator/promoter sequence regulates the mer operon in Thermus thermophilus HB 27; in the absence of inorganic mercury, merR, the repressor protein (BBa_M33335) binds to this sequence, preventing transcription of the downstream operon. In the presence of inorganic mercury, merR undergoes a conformation change, unblocking this promoter and allowing the downstream operon to be transcribed. false false _577_ 0 6927 9 Not in stock false We only knew that the promoter sequence was located 69 bp upstream of the merR operon, so we isolated the 160 bp sequence directly upstream of the operon. false Christopher Brunson BBa_M33336_sequence 1 atggtgatgaactcctgggccaggcccagacctgcgagcgtcaaagcggcaaggatcagcttcctcatacacacctccttggtgccgccggtagtatacccggcccttgcccttctggcaagcgccgcgcggcccagggaggggtttttcgctagactagggggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z