BBa_M33351 1 BBa_M33351 Ptod promoter activated by TodT protein 2010-06-05T11:00:00Z 2015-05-08T01:14:01Z The sequence of the Ptod promoter was given in the following article. Lacal, J., Guazzaroni, M. E., Busch, A., Krell, T. & Ramos, J. L. (2008). Hierarchical binding of the TodT response regulator to its multiple recognition sites at the tod pathway operon promoter. J. Mol. Biol. 376, 325???337. This identical sequence was found upstream of the todX gene sequence natural existent in Pseudomonas putida given at http://www.ncbi.nlm.nih.gov/nuccore/AB042508.1 (todX coordinates: 14325..15686). Pseudomonas putida possesses a two-component regulatory system (TCS) which can sense changes in the toluene level of the environment. TodS and TodT proteins control the expression of genes involved in the degradation of toluene, benzene, and ethylbenzene via the toluene dioxygenase pathway. The catabolic genes of the toluene dioxygenase pathway are transcribed from a single promoter termed Ptod, located upstream from the todX gene. The TodS/TodT TCS mediate Ptod in response to toluene and other aromatic hydrocarbons. Ptod is activated once the response regulator TodT is phosphorylated by the TodS sensor kinase in response to pathway substrates. This part should be used in conjunction with false false _577_ 0 6929 9 Not in stock false We added restriction digestion sites to ensure compliance with Assembly Standard 10. We also modified the stop codon to TAA. false Sunny Kim annotation2070202 1 pTod promoter range2070202 1 1 116 BBa_M33351_sequence 1 ggcataaaccatcgtttatcacagttaaactttggttttctaagttgcgatagccatataaacccataagccaaaaaacaatatttcccagggcgtgattgtaatactgtgcgtgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z