BBa_M33354 1 BBa_M33354 RBS+CDS for TodT protein 2010-06-05T11:00:00Z 2015-05-08T01:14:02Z This is a genomic sequence from Pseudomonas putida. The was obtained from GenBank at http://www.ncbi.nlm.nih.gov/nuccore/4914628 (Y18245.1; todT coordinates: 14162..14845). Pseudomonas putida possesses a two-component regulatory system (TCS) which can sense changes in the toluene level of the environment. TodS and TodT proteins control the expression of genes involved in the degradation of toluene, benzene, and ethylbenzene via the toluene dioxygenase pathway. In response to toluene and other aromatic hydrocarbons, the TodS/TodT TCS mediate a single promoter termed pTod, which transcribes the catabolic genes involved in the toluene dioxygenase pathway. TodT is phosphorylated by the protein kinase TodS, and it can also increase the autophosphorylation activity of TodS. Once TodT is activated, it binds to a site on the pTod promoter approximately 107 base pairs upstream from the RNA polymerase-binding site. DNA bending caused by integration host factor (IHF) enables contact between TodT and RNA polymerase, initiating transcription. This part should be used in conjunction with BBa_M33351, the Ptod promoter, and BBa_M33350/BBa_M33352, the todS protein sequence. false false _577_ 0 6925 9 Not in stock false Made 1 silent mutation for XbaI, to ensure compliance with Assembly Standard 10. We also modified the stop codon to TAA, and added a strong ribosome binding site (BBa_B0034). false Alejandro Virrueta component2070247 1 BBa_M33353 component2070245 1 BBa_B0034 annotation2070245 1 BBa_B0034 range2070245 1 1 12 annotation2070247 1 BBa_M33353 range2070247 1 19 702 BBa_M33353 1 BBa_M33353 CDS for TodT protein 2010-06-05T11:00:00Z 2015-05-08T01:14:02Z This is a genomic sequence from Pseudomonas putida. The was obtained from GenBank (Y18245.1; http://www.ncbi.nlm.nih.gov/nuccore/4914628). Pseudomonas putida possesses a two-component regulatory system (TCS) which can sense changes in the toluene level of the environment. TodS and TodT proteins control the expression of genes involved in the degradation of toluene, benzene, and ethylbenzene via the toluene dioxygenase pathway. In response to toluene and other aromatic hydrocarbons, the TodS/TodT TCS mediate a single promoter termed pTod, which transcribes the catabolic genes involved in the toluene dioxygenase pathway. TodT is phosphorylated by the protein kinase TodS, and it can also increase the autophosphorylation activity of TodS. Once TodT is activated, it binds to a site on the pTod promoter approximately 107 base pairs upstream from the RNA polymerase-binding site. DNA bending caused by integration host factor (IHF) enables contact between TodT and RNA polymerase, initiating transcription. This part should be used in conjunction with BBa_M33351, the Ptod promoter, and BBa_M33350/BBa_M33352, the todS protein sequence. false false _577_ 0 6925 9 Not in stock false Restriction sites for EcorI, XbaI, SpeI, and PstI were removed from the sequence. false Alejandro Virrueta annotation2070243 1 todT range2070243 1 1 684 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_M33353_sequence 1 atgcccgcccgctgggggtgcttgtttcctggtaagtatccctgccagacagggctccggcacatgagtgatcgggcatctgttatctatatcctcgatgacgacaatgcagtactggaagcactgagcagcttggtgcgttcaatcggcctgagtgtcgagtgtttttcatccgctagcgtattcctgaacgatgtcaatcgctctgcctgtggctgtctaattttggatgtccgtatgcccgagatgagcgggttggatgtgcaacgacaactgaaagagcttggcgagcaaatccccattatttttatcagcggccacggtgatattccgatggcagtcaaagcgatcaaggcgggtgcggtagacttcttcactaaaccttttcgagaagaggagctgcttggcgctattcgcgccgcgctgaagttggcgccccagcagagatcaaacgctccccgagtcagcgagcttaaagagaattacgaaagcctcagcaaacgcgagcaacaggtgcttaagttcgtcttgcgaggatatctaaacaagcagacggccctagagcttgatatatcggaagcaacagtgaaagtgcaccgccataatatcatgaggaaaatgaaagtatcttcaatccaggatctggttcgagtaactgagcggctcaaggatagcctggaataa BBa_M33354_sequence 1 aaagaggagaaatactagatgcccgcccgctgggggtgcttgtttcctggtaagtatccctgccagacagggctccggcacatgagtgatcgggcatctgttatctatatcctcgatgacgacaatgcagtactggaagcactgagcagcttggtgcgttcaatcggcctgagtgtcgagtgtttttcatccgctagcgtattcctgaacgatgtcaatcgctctgcctgtggctgtctaattttggatgtccgtatgcccgagatgagcgggttggatgtgcaacgacaactgaaagagcttggcgagcaaatccccattatttttatcagcggccacggtgatattccgatggcagtcaaagcgatcaaggcgggtgcggtagacttcttcactaaaccttttcgagaagaggagctgcttggcgctattcgcgccgcgctgaagttggcgccccagcagagatcaaacgctccccgagtcagcgagcttaaagagaattacgaaagcctcagcaaacgcgagcaacaggtgcttaagttcgtcttgcgaggatatctaaacaagcagacggccctagagcttgatatatcggaagcaacagtgaaagtgcaccgccataatatcatgaggaaaatgaaagtatcttcaatccaggatctggttcgagtaactgagcggctcaaggatagcctggaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z