BBa_M36009 1 BBa_M36009 5' Bicistronic UTR (strong), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false please see long description. false Drew Endy BBa_M36004 1 BBa_M36004 predicted glycogen synthesis protein (w/ UTR&term) 2011-04-27T11:00:00Z 2015-05-08T01:14:02Z Genomic sequence for glgS as provided on EcoCyc database. Codes for a protein involved in the biosynthesis of glycogen. Overproduction stimulates glycogen synthesis. Influences the first two enzymes in the e coli glycogen biosynthesis pathway (glucose-1-phosphate adenylyltransferase, glycogen synthase). See http://BioCyc.org/ECOLI/NEW-IMAGE?type=GENE-IN-REG-SUMMARY&object=EG11381 for more information. false false _848_ 0 9641 9 Not in stock false false Jesse Palmer, Elliot Lui component2117838 1 BBa_M36008 component2117839 1 BBa_M36010 component2117837 1 BBa_M36009 annotation2117837 1 BBa_M36009 range2117837 1 1 47 annotation2117838 1 BBa_M36008 range2117838 1 54 254 annotation2117839 1 BBa_M36010 range2117839 1 263 344 BBa_M36008 1 BBa_M36008 predicted glycogen synthesis protein 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Genomic sequence glgS as provided on EcoCyc database. Codes for a protein involved in the biosynthesis of glycogen. Overproduction stimulates glycogen synthesis. Influences the first two enzymes in the e coli glycogen biosynthesis pathway (glucose-1-phosphate adenylyltransferase, glycogen synthase). See http://BioCyc.org/ECOLI/NEW-IMAGE?type=GENE-IN-REG-SUMMARY&object=EG11381 for more information. false false _848_ 0 9641 9 Not in stock false false Jesse Palmer, Elliot Lui annotation2119219 1 stop range2119219 1 199 201 annotation2119218 1 start range2119218 1 1 3 BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36008_sequence 1 atggatcatagtcttaattctttaaataatttcgatttcctggcgcgtagttttgccagaatgcacgcagaaggtcgcccggtcgatattctggccgttactggtaacatggatgaagaacatagaacctggttttgcgcacgttatgcctggtattgtcaacagatgatgcaggcaagagagctggagttagagcactga BBa_M36004_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaatactagatggatcatagtcttaattctttaaataatttcgatttcctggcgcgtagttttgccagaatgcacgcagaaggtcgcccggtcgatattctggccgttactggtaacatggatgaagaacatagaacctggttttgcgcacgttatgcctggtattgtcaacagatgatgcaggcaagagagctggagttagagcactgatactagagtcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36009_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z