BBa_M36008 1 BBa_M36008 predicted glycogen synthesis protein 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Genomic sequence glgS as provided on EcoCyc database. Codes for a protein involved in the biosynthesis of glycogen. Overproduction stimulates glycogen synthesis. Influences the first two enzymes in the e coli glycogen biosynthesis pathway (glucose-1-phosphate adenylyltransferase, glycogen synthase). See http://BioCyc.org/ECOLI/NEW-IMAGE?type=GENE-IN-REG-SUMMARY&object=EG11381 for more information. false false _848_ 0 9641 9 Not in stock false false Jesse Palmer, Elliot Lui annotation2119219 1 stop range2119219 1 199 201 annotation2119218 1 start range2119218 1 1 3 BBa_M36008_sequence 1 atggatcatagtcttaattctttaaataatttcgatttcctggcgcgtagttttgccagaatgcacgcagaaggtcgcccggtcgatattctggccgttactggtaacatggatgaagaacatagaacctggttttgcgcacgttatgcctggtattgtcaacagatgatgcaggcaagagagctggagttagagcactga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z