BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z