BBa_M36011 1 BBa_M36011 Fur-regulated (Fe) Promoter 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z 1. Gunter K, Toupet C, Schupp T. Characterization of an iron-regulated promoter involved in desferrioxamine B synthesis in Streptomyces pilosus: repressor-binding site and homology to the diphtheria toxin gene promoter. Journal of bacteriology. 1993;175(11):3295-302. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=204726&tool=pmcentrez&rendertype=abstract. pPS-PCR is a promoter which is controlled by the iron-repressive transcription factor, Fur. false false _848_ 0 9646 9 Not in stock false Based on deletion analysis of natural S. lividans gene false Brent Townshend annotation2119771 1 Possible repressor region range2119771 1 102 120 annotation2119770 1 SpeI range2119770 1 159 164 annotation2119769 1 start range2119769 1 112 112 annotation2119767 1 -35 range2119767 1 82 87 annotation2119768 1 -10 range2119768 1 103 108 annotation2119772 1 SalI range2119772 1 95 100 BBa_M36011_sequence 1 gactgcaaagccggcgctccggtgaacgcttcacggccaatcgctgtgcatccggccacagttgacgggaatcaccccctgtggacttcctcaggtcgacattaggttaggctcacctaagttcatcgccccctgtggtgctcacccccaggagcatcactagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z