BBa_M36015 1 BBa_M36015 coding sequence for foobobalase enyzme 2011-11-28T12:00:00Z 2015-05-08T01:14:02Z i made this up from scartch blah blahn allong adescripwegn horrible job true false _848_ 0 52 432 Discontinued false nothing. since this is garbage... false Drew Endy annotation2166134 1 Foobob coding sequence range2166134 1 51 81 annotation2166137 1 misc range2166137 1 1 106 annotation2166133 1 TetR binding site range2166133 1 21 41 BBa_M36015_sequence 1 tatagctagctgatcgatgctgatctacgtagctgatgctagctacttactagctgactgatcgatcgtagctagctgactgatcgtagctgatcgatgctagctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z