BBa_M36025 1 BBa_M36025 phiX174 gene B - mutated rbs of K 2011-05-02T11:00:00Z 2015-05-08T01:14:02Z wt phiX174, then mutated by Jon Rodriguez and Adrian Sierra Took the wt gene B from coliphage phiX174, and then mutated it synonymously in order to destroy the overlapping RBS of gene K false false _848_ 0 9553 9 Not in stock false Made only synonymous changes, and tried to keep the codon usage bias as similar as possible to wt. false Jon Rodriguez annotation2119069 1 CDS range2119069 1 1 363 annotation2119068 1 Stop Codon range2119068 1 361 363 annotation2119119 1 a->t range2119119 1 354 354 annotation2119066 1 Start Codon range2119066 1 1 3 BBa_M36025_sequence 1 atggaacaactcactaaaaaccaagctgtcgctacttcccaagaagctgttcagaatcagaatgagccgcaacttcgggatgaaaatgctcacaatgacaaatctgtccacggagtgcttaatccaacttaccaagctgggttacgacgcgacgccgttcaaccagatattgaagcagaacgcaaaaagagagatgagattgaggctgggaaaagttactgtagccgacgttttggcggcgcaacctgtgacgacaaatctgctcaaatttatgcgcgcttcgataaaaatgattggcgtatccaacctgcagagttttatcgcttccatgacgcagaagttaacactttcggttatttctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z