BBa_M36026 1 BBa_M36026 phiX174 gene K - mutated rbs and start codon of C 2011-05-02T11:00:00Z 2015-05-08T01:14:02Z wt phiX174, then mutated by Jon Rodriguez and Adrian Sierra Took the wt gene K from coliphage phiX174, and then mutated it synonymously in order to destroy the RBS and start codon of the overlapping gene C. false false _848_ 0 9553 9 Not in stock false Made only synonymous changes, and tried to keep the codon usage bias as similar as possible to wt, according to this table http://openwetware.org/wiki/Escherichia_coli/Codon_usage false Jon Rodriguez annotation2119131 1 g->c range2119131 1 72 72 annotation2119072 1 CDS range2119072 1 1 171 annotation2119071 1 stop codon range2119071 1 169 171 annotation2119137 1 g->c range2119137 1 75 75 annotation2119070 1 start codon range2119070 1 1 3 annotation2119142 1 t->c range2119142 1 84 84 BBa_M36026_sequence 1 atgagtcgaaaaattatcttgataaagcaggaattactactgcttgtttacgaattaaatcgaagtggactcctcgcggaaaacgagaaaattcgacctatccttgcgcagctcgagaagctcttactttgcgacctttcgccatcaactaacgattctgtcaaaaactga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z