BBa_M36027 1 BBa_M36027 phiX174 gene C - mutated rbs and start codon of D 2011-05-02T11:00:00Z 2015-05-08T01:14:02Z wt phiX174, then mutated by Jon Rodriguez and Adrian Sierra Took the wt gene C from coliphage phiX174, and then mutated it synonymously in order to destroy the RBS and start codon of the overlapping gene D. false false _848_ 0 9553 9 Not in stock false Made only synonymous changes, and tried to keep the codon usage bias as similar as possible to wt, according to this table http://openwetware.org/wiki/Escherichia_coli/Codon_usage false Jon Rodriguez annotation2119075 1 CDS range2119075 1 1 261 annotation2119074 1 stop codon range2119074 1 259 261 annotation2119118 1 t->c range2119118 1 249 249 annotation2119073 1 start codon range2119073 1 1 3 annotation2119121 1 a->t range2119121 1 258 258 annotation2119105 1 a->c range2119105 1 246 246 BBa_M36027_sequence 1 atgagaaaattcgacctatccttgcgcagctcgagaagctcttactttgcgacctttcgccatcaactaacgattctgtcaaaaactgacgcgttggatgaggagaagtggcttaatatgcttggcacgttcgtcaaggactggtttagatatgagtcacattttgttcatggtagagattctcttgttgacattttaaaagagcgtggattactatctgagtccgatgctgttcaaccactaatcggcaagaaatcttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z