BBa_M36034 1 BBa_M36034 BCD02 - Bicistronic Design 02 2013-10-23T11:00:00Z 2015-05-08T01:14:02Z We found it in a parts registry linked to from the paper detailed in the description of this part This part is the bicistronic with the highest expression of GFP in a paper or bicistronics entitled "Precise and reliable gene expression via standard transcription and translation initiation elements" (Mutalek 2012). false false _848_ 0 19059 9 Not in stock false The start codon at the end had to be removed false Jacob Waggoenr BBa_M36034_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttcta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z