BBa_M36038 1 BBa_M36038 PoPS->Alpha Factor Mating Pheromone 2011-12-20T12:00:00Z 2015-05-08T01:14:02Z partsregistry.org Sequence of the Alpha Factor Mating Pheromone Generator from Yeast Genome This composite part is a medium strength RBS, the Alpha Factor Mating Pheromone Generator, and a strong terminator false false _848_ 0 11098 9 Not in stock false This composite part is designed to be put directly after a Rhamnose sensor in a plasmid containing an ampicillin resistance gene in E. coli. false Joe Schlicht, Trevor! Kalkus, and David Eduardo Arrambide Montemayor component2167439 1 BBa_B1006 component2167434 1 BBa_M36037 component2167433 1 BBa_B0064 annotation2167433 1 BBa_B0064 range2167433 1 1 12 annotation2167434 1 BBa_M36037 range2167434 1 21 59 annotation2167439 1 BBa_B1006 range2167439 1 68 106 BBa_B0064 1 BBa_B0064 Tuned RBS for Q04401 2008-02-23T12:00:00Z 2015-08-31T04:07:21Z . This is a single bp change from B0034. It's strength is approximately 35% that of B0034. false false _11_ 0 2 84 Not in stock false . false Jason Kelly BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898431 1 PolyA range1898431 1 1 9 annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898428 1 B1006 range1898428 1 1 39 BBa_M36037 1 BBa_M36037 Alpha Factor Mating Pheromone Producer 2011-12-10T12:00:00Z 2015-05-08T01:14:02Z This sequence originated from the coding for the thirteen amino acids for the pheromone in yeast. This gene encodes the thirteen amino acids that make up the Alpha factor yeast mating pheromone. In high enough concentrations it can lead to apoptosis in a-mating factor yeast and in low concentrations it induces mating. It is codon optimized for e coli. false false _848_ 0 11098 9 Not in stock false The gene has been optimized for e coli. false Joe Schlicht, Trevor! Kalkus, and David Eduardo Arrambide Montemayor BBa_B0064_sequence 1 aaagaggggaaa BBa_M36037_sequence 1 tggcattggctgcagctgaaaccgggtcagccgatgtat BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_M36038_sequence 1 aaagaggggaaatactagagtggcattggctgcagctgaaaccgggtcagccgatgtattactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z