BBa_M36051 1 BBa_M36051 LexA regulated promoter 2011-05-01T11:00:00Z 2015-05-08T01:14:02Z escherichia coli k -12 This is the promoter sequence for the LexA gene. The lexA protein regulates its own promoter. There is a common binding site for the lexA protein found in this promoter that is also found in ~40 other SOS genes. false true _848_ 0 9234 9 Not in stock false We know exactly were the lexA protein binds, but we are not entirely sure of the exact deliniation of the promoter itself. Therefore this sequence may contain superfluous information. false Ryan Kent annotation2119368 1 lexA binding range2119368 1 77 80 annotation2119367 1 8 nt spacer range2119367 1 69 76 annotation2119366 1 lexA binding range2119366 1 65 68 BBa_M36051_sequence 1 cccttccagaattcgataaatctctggtttattgtgcagtttatggttccaaaatcgccttttgctgtatatactcacagcataactgtatatac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z