BBa_M36050 1 BBa_M36050 LexA gene 2011-05-01T11:00:00Z 2015-05-08T01:14:02Z escherichia coli k-12 LexA is a repressor that represses SOS response genes coding for DNA polymerases required for repairing DNA damage. false false _848_ 0 9234 9 Not in stock false N/A false Ryan Kent, Evan Clark annotation2119200 1 stop range2119200 1 609 609 annotation2119199 1 start range2119199 1 1 1 annotation2118549 1 lexA range2118549 1 1 609 BBa_M36053 1 BBa_M36053 DNA damage sensor 2011-05-01T11:00:00Z 2015-05-08T01:14:02Z composite This part senses damaged DNA by using endogenous recA to cleave the provided lexA and prevent it from repressing the provided lexA promoter. false false _848_ 0 9234 9 Not in stock false This construct is using a medium strength promoter and 5'UTR so that the amount of lexA won't be so great as to not allow for endogenous levels of recA false Ryan Kent component2118574 1 BBa_M36051 component2118573 1 BBa_M36010 component2118570 1 BBa_J23106 component2118571 1 BBa_M36001 component2118572 1 BBa_M36050 annotation2118573 1 BBa_M36010 range2118573 1 692 773 annotation2118570 1 BBa_J23106 range2118570 1 1 35 annotation2118571 1 BBa_M36001 range2118571 1 36 82 annotation2118572 1 BBa_M36050 range2118572 1 83 691 annotation2118574 1 BBa_M36051 range2118574 1 774 868 BBa_M36051 1 BBa_M36051 LexA regulated promoter 2011-05-01T11:00:00Z 2015-05-08T01:14:02Z escherichia coli k -12 This is the promoter sequence for the LexA gene. The lexA protein regulates its own promoter. There is a common binding site for the lexA protein found in this promoter that is also found in ~40 other SOS genes. false true _848_ 0 9234 9 Not in stock false We know exactly were the lexA protein binds, but we are not entirely sure of the exact deliniation of the promoter itself. Therefore this sequence may contain superfluous information. false Ryan Kent annotation2119366 1 lexA binding range2119366 1 65 68 annotation2119368 1 lexA binding range2119368 1 77 80 annotation2119367 1 8 nt spacer range2119367 1 69 76 BBa_M36001 1 BBa_M36001 5' Bicistronic UTR (medium), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Vivek Mutalik et al. c/o BIOFAB Emeryville. 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false Please see long description. false Drew Endy BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36001_sequence 1 tatagagggtattaataatgtatggattaaagggggaggcataacaa BBa_M36051_sequence 1 cccttccagaattcgataaatctctggtttattgtgcagtttatggttccaaaatcgccttttgctgtatatactcacagcataactgtatatac BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_M36050_sequence 1 atgaaagcgttaacggccaggcaacaagaggtgtttgatctcatccgtgatcacatcagccagacaggtatgccgccgacgcgtgcggaaatcgcgcagcgtttggggttccgttccccaaacgcggctgaagaacatctgaaggcgctggcacgcaaaggcgttattgaaattgtttccggcgcatcacgcgggattcgtctgttgcaggaagaggaagaagggttgccgctggtaggtcgtgtggctgccggtgaaccacttctggcgcaacagcatattgaaggtcattatcaggtcgatccttccttattcaagccgaatgctgatttcctgctgcgcgtcagcgggatgtcgatgaaagatatcggcattatggatggtgacttgctggcagtgcataaaactcaggatgtacgtaacggtcaggtcgttgtcgcacgtattgatgacgaagttaccgttaagcgcctgaaaaaacagggcaataaagtcgaactgttgccagaaaatagcgagtttaaaccaattgtcgttgaccttcgtcagcagagcttcaccattgaagggctggcggttggggttattcgcaacggcgactggctgtaa BBa_M36053_sequence 1 tttacggctagctcagtcctaggtatagtgctagctatagagggtattaataatgtatggattaaagggggaggcataacaaatgaaagcgttaacggccaggcaacaagaggtgtttgatctcatccgtgatcacatcagccagacaggtatgccgccgacgcgtgcggaaatcgcgcagcgtttggggttccgttccccaaacgcggctgaagaacatctgaaggcgctggcacgcaaaggcgttattgaaattgtttccggcgcatcacgcgggattcgtctgttgcaggaagaggaagaagggttgccgctggtaggtcgtgtggctgccggtgaaccacttctggcgcaacagcatattgaaggtcattatcaggtcgatccttccttattcaagccgaatgctgatttcctgctgcgcgtcagcgggatgtcgatgaaagatatcggcattatggatggtgacttgctggcagtgcataaaactcaggatgtacgtaacggtcaggtcgttgtcgcacgtattgatgacgaagttaccgttaagcgcctgaaaaaacagggcaataaagtcgaactgttgccagaaaatagcgagtttaaaccaattgtcgttgaccttcgtcagcagagcttcaccattgaagggctggcggttggggttattcgcaacggcgactggctgtaatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccccttccagaattcgataaatctctggtttattgtgcagtttatggttccaaaatcgccttttgctgtatatactcacagcataactgtatatac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z