BBa_M36067 1 BBa_M36067 fnr-gal4 hybrid 2013-06-09T11:00:00Z 2015-05-08T01:14:02Z The 753-bp FNR coding sequence was isolated from K-12 DH10B E. coli, as reported on the E. coli Wiki and the Generic Genome Browser. Analysis of the 3-D structure of the protein suggested that the N-terminal would be the least interruptive location for the placement of a hybrid activation region spliced from GAL4. As such, the coding sequence for the GAL4 activating region was placed between the start and the second codons of the previously obtained FNR sequence. The coding sequence for the GAL4 activation domain was obtained from Clontech???s pGAD424 plasmid , which is used to generate hybrid GAL4 proteins for two-hybrid screens in both E. coli and S. cerevisiae. The plasmid sequence, as designed by Clontech, includes three nuclear localization signals, which were retained in the final gene design. This part codes for the fnr-gal4 protein. FNR is a transcriptional activator in E. coli that is sensitive to oxygen levels. The protein is has an iron-sulfur code that, when bound to oxygen, undergoes a conformational change that reduces its ability to activate transcription. This particular coding sequence includes a nuclear localization sequence at the N-terminus (for application in eukaryotes), a gal4 activation domain (also at the N-terminus), and a stop codon. false false _848_ 0 17294 9 Not in stock false The N terminus of the sequence was chosen in order to minimize the likelihood of disrupting the protein's current function. false Rahul Sastry, Anjan Katta annotation2329349 1 stop range2329349 1 1153 1155 annotation2329351 1 SV40 NLS range2329351 1 7 63 annotation2329348 1 fnr protein range2329348 1 405 1152 annotation2329350 1 GAL4 activation domain range2329350 1 67 405 BBa_M36067_sequence 1 gataaagcggaattaattcccgagcctccaaaaaagaagagaaaggtcgaattgggtaccgccgccaattttaatcaaagtgggaatattgctgatagctcattgtccttcactttcactaacagtagcaacggtccgaacctcataacaactcaaacaaattctcaagcgctttcacaaccaattgcctcctctaacgttcatgataacttcatgaataatgaaatcacggctagtaaaattgatgatggtaataattcaaaaccactgtcacctggttggacggaccaaactgcgtataacgcgtttggaatcactacagggatgtttaataccactacaatggatgatgtatataactatctattcgatgatgaagataccccaccaaacccaaaaaaagagatcccggaaaagcgaattatacggcgcattcagtctggcggttgtgctatccattgccaggattgcagcatcagccagctttgcatcccgttcacactcaacgaacatgagcttgatcagcttgataatatcattgagcggaagaagcctattcagaaaggccagacgctgtttaaggctggtgatgaacttaaatcgctttatgccatccgctccggtacgattaaaagttataccatcactgagcaaggcgacgagcaaatcactggtttccatttagcaggcgacctggtgggatttgacgccatcggcagcggccatcacccgagcttcgcgcaggcgctggaaacctcgatggtatgtgaaatcccgttcgaaacgctggacgatttgtccggtaaaatgccgaatctgcgtcagcagatgatgcgtctgatgagcggtgaaatcaaaggcgatcaggacatgatcctgctgttgtcgaagaaaaatgccgaggaacgtctggctgcattcatctacaacctgtcccgtcgttttgcccaacgcggcttctcccctcgtgaattccgcctgacgatgactcgtggcgatatcggtaactatctgggcctgacggtagaaaccatcagccgtctgctgggtcgcttccagaaaagcggcatgctggcagtcaaaggtaaatacatcaccatcgaaaataacgatgcgctggcccagcttgctggtcatacgcgtaacgttgcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z