BBa_M36068 1 BBa_M36068 Adapted fnr binding site 2013-06-09T11:00:00Z 2015-05-08T01:14:02Z The DNA sequence recognized by FNR consists of an inverted repeat with a consensus sequence of TTGATnnnnATCAA. To create an appropriately sized and spaced eukaryotic promoter that would be recognized by FNR, we adopted the GAL4 Upstream Activating Sequences (UAS) from the Invitrogen pGene/V5-His A plasmid. The 6 GAL4 binding sites were replaced with 3 FNR binding sites (to minimize repeats and, therefore, simplify DNA production), and the sequence was truncated about 30 bp after the included TATA box. This sequence is an adapted binding site for the FNR (fumarate and nitrate reductase) protein. FNR is a transcriptional activator that, when functional, should bind to this site and recruit RNA polymerase. false false _848_ 0 17294 9 Not in stock false The size of the sequence and number of included binding sites had to be greatly reduced in order to minimize repeats and facilitate synthesis. false Rahul Sastry, Anjan Katta annotation2329352 1 fnr binding site range2329352 1 24 37 annotation2329353 1 fnr binding site range2329353 1 55 68 annotation2329355 1 tata box range2329355 1 81 93 annotation2329354 1 fbr binding site range2329354 1 40 53 BBa_M36068_sequence 1 ccgagctcttacgcgggtcgaagttgattacgatcaaagttgattacgatcaaattgattacgatcaaagtcgactctagagggtatataatggatctcgagatatcggagctcgtttagtgaaccgtca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z