BBa_M36071 1 SoDA K12 e.coli native Manganese Superoxide Dismutase 2012-12-07T12:00:00Z 2015-05-08T01:14:02Z This sequence is derived from the amino acid sequence of Mn-SOD protein found from Durfee et. al at the University of Wisconsin which also provided the entire genomic sequence of the E. coli (strain: k-12, substrain: DH10B) genome. Coding sequence for the enzyme Mn-SOD. This protein catalyzes the dismutation of superoxide, a free radical. Sequence found by converting the amino acid sequence of Mn-SOD protein native to Escherichia coli, the organism for which it is also optimized for. false false _848_ 0 15057 9 Not in stock false This DNA sequence is converted from the amino acid sequence of Mn-SOD protein using the online converter from In-Silico. false Alex Rosay, Justin Diep, Ben Blankenmeister annotation2213706 1 Start Codon range2213706 1 1 3 BBa_M36071_sequence 1 atgtcttatactctgccaagtctgccctacgcgtatgacgctctcgagccccattttgataagcagacgatggaaattcatcacacaaaacatcatcaaacctacgtcaataatgccaatgctgctctcgagtccttgcccgagttcgccaacttgccagtggaggagctgataaccaaattggaccagctaccggccgataaaaagaccgtactgcggaacaacgcgggcgggcatgctaaccattccttgttctggaaaggactgaagaagggcacgacgctgcagggtgatctgaaggcagccatagaacgggatttcgggtccgttgataactttaaagcggaattcgaaaaggcagcagcaagccgatttgggtccggatgggcttggcttgtattgaagggcgacaaattggcggtagtctcgacggcaaaccaagatagcccactaatgggtgaggcgatctcaggggcgtcaggcttcccgattatgggcctggacgtgtgggaacacgcgtactacctgaagttccagaaccgccggcccgactacattaaagagttttggaatgtagttaattgggatgaagctgcagcccggttcgcggcaaagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z