BBa_M36070 1 BBa_M36070 Bicistronic RBS - BIOFAB ID: apFAB681 (BCD1) 2012-12-07T12:00:00Z 2015-05-08T01:14:02Z Biofab.org's BCD+GOI promoter library: http://io.biofab.org:5000/simple/bd_gois Bicistronic RBS with high levels of expression. Strain performance: 435.43 Strain performance SD: 53.55 false false _848_ 0 15056 9 Not in stock false N/a false Alex Rosay, Justin Diep, Ben Blankenmeister BBa_M36071 1 SoDA K12 e.coli native Manganese Superoxide Dismutase 2012-12-07T12:00:00Z 2015-05-08T01:14:02Z This sequence is derived from the amino acid sequence of Mn-SOD protein found from Durfee et. al at the University of Wisconsin which also provided the entire genomic sequence of the E. coli (strain: k-12, substrain: DH10B) genome. Coding sequence for the enzyme Mn-SOD. This protein catalyzes the dismutation of superoxide, a free radical. Sequence found by converting the amino acid sequence of Mn-SOD protein native to Escherichia coli, the organism for which it is also optimized for. false false _848_ 0 15057 9 Not in stock false This DNA sequence is converted from the amino acid sequence of Mn-SOD protein using the online converter from In-Silico. false Alex Rosay, Justin Diep, Ben Blankenmeister annotation2213706 1 Start Codon range2213706 1 1 3 BBa_M36072 1 SoDA Superoxide Dismutase A Actuator 2012-12-07T12:00:00Z 2015-05-08T01:14:02Z Durfee et al. "The Complete Genome Sequence of Escherichia coli DH10B: Insights into the Biology of a Laboratory Workhorse" 1 Feb 2008. This device includes a strong bicistronic RBS (BBa_M36070), the enzyme sequence of sodA (BBa_M36071), and a strong terminator (BBa_B0010) that takes the input signal PoPs to produce sodA, an enzyme that dismutates superoxide free radicals. false false _848_ 0 15057 9 Not in stock false The encoded enzyme sequence (BBa_M36070) was derived from converting the amino acid sequence of sodA obtained from Durfee et al. from the University of Wisconsin (obtained from E. coli strain: k-12, substrain: DH10B genome). false Justin Diep, Alex Rosay, Ben Blankenmeister component2213707 1 BBa_M36070 component2213709 1 BBa_M36071 component2213710 1 BBa_B0010 annotation2213710 1 BBa_B0010 range2213710 1 721 800 annotation2213709 1 BBa_M36071 range2213709 1 95 712 annotation2213707 1 BBa_M36070 range2213707 1 1 88 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_M36070_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcacaggagactttctaatg BBa_M36071_sequence 1 atgtcttatactctgccaagtctgccctacgcgtatgacgctctcgagccccattttgataagcagacgatggaaattcatcacacaaaacatcatcaaacctacgtcaataatgccaatgctgctctcgagtccttgcccgagttcgccaacttgccagtggaggagctgataaccaaattggaccagctaccggccgataaaaagaccgtactgcggaacaacgcgggcgggcatgctaaccattccttgttctggaaaggactgaagaagggcacgacgctgcagggtgatctgaaggcagccatagaacgggatttcgggtccgttgataactttaaagcggaattcgaaaaggcagcagcaagccgatttgggtccggatgggcttggcttgtattgaagggcgacaaattggcggtagtctcgacggcaaaccaagatagcccactaatgggtgaggcgatctcaggggcgtcaggcttcccgattatgggcctggacgtgtgggaacacgcgtactacctgaagttccagaaccgccggcccgactacattaaagagttttggaatgtagttaattgggatgaagctgcagcccggttcgcggcaaagaaa BBa_M36072_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcacaggagactttctaatgtactagatgtcttatactctgccaagtctgccctacgcgtatgacgctctcgagccccattttgataagcagacgatggaaattcatcacacaaaacatcatcaaacctacgtcaataatgccaatgctgctctcgagtccttgcccgagttcgccaacttgccagtggaggagctgataaccaaattggaccagctaccggccgataaaaagaccgtactgcggaacaacgcgggcgggcatgctaaccattccttgttctggaaaggactgaagaagggcacgacgctgcagggtgatctgaaggcagccatagaacgggatttcgggtccgttgataactttaaagcggaattcgaaaaggcagcagcaagccgatttgggtccggatgggcttggcttgtattgaagggcgacaaattggcggtagtctcgacggcaaaccaagatagcccactaatgggtgaggcgatctcaggggcgtcaggcttcccgattatgggcctggacgtgtgggaacacgcgtactacctgaagttccagaaccgccggcccgactacattaaagagttttggaatgtagttaattgggatgaagctgcagcccggttcgcggcaaagaaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z