BBa_M36080 1 BBa_M36080 Wild-type miraculin protein with His-tag at C-terminus 2013-10-23T11:00:00Z 2015-05-08T01:14:02Z The sequence is from the UniProt database (P13087) without the C-terminus signal peptide. This is the coding gene for the protein naturally found in the miracle berry (Synsepalum dulcificum). The protein is his-tagged at the C-terminus (with a poly-glycine linker) for purification. In the berry the protein is produced as a glycoprotein dimer, in which form it has taste-modifying properties. false false _848_ 0 19060 9 Not in stock false Miraculin naturally has exposed histidine tags which allow for metal ion purification, yet attaching the his-tag should allow for greater concentrations of purified protein. false Dan Sakaguchi annotation2370561 1 Poly-glycine linker range2370561 1 574 582 annotation2370562 1 6xHis tag range2370562 1 583 600 annotation2370560 1 Miraculin Protein range2370560 1 1 573 BBa_M36080_sequence 1 gattccgctccgaacccggtgctggacatcgatggcgagaaactgcgcaccggtactaactactacatcgttccggttctgcgcgatcacggcggcggtcttaccgtaagtgcaactaccccgaacggtactttcgtgtgcccgccacgcgtagtgcagacccgtaaagaagttgaccatgatcgcccgctggcgttcttcccggaaaaccctaaagaggatgtagtacgtgtatctaccgacctgaacatcaacttctctgcgttcatgccgtgccgctggaccagctccaccgtatggcgtctggacaaatatgatgagtccaccggtcagtattttgttactattggcggtgttaaaggtaatccgggtccggaaaccatctctagctggttcaaaatcgaagaattttgtggttctggtttctataaacttgtattctgcccgaccgtttgcggctcatgcaaggttaaatgcggtgatgtgggtatctacattgaccaaaaaggccgtcgtcgtctggcactgtctgataaaccgttcgcatttgaatttaataaaaccgtttatttcggtggtggtcatcaccaccaccatcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z