BBa_M36082 1 BBa_M36082 Winter Flounder Antifreeze Protein 2014-04-29T11:00:00Z 2015-05-08T01:14:02Z Uniprot The Antifreeze Protein DNA false false _848_ 0 22183 9 Not in stock false We simply got the sequence off of Uniprot so that we could create the basic part to integrate into our actuator false Ashley Hammerbacher Celina Malav?? BBa_M36082_sequence 1 atggcgctgagcctgtttaccgtgggccagctgatttttctgttttggaccatgcgcattaccgaagcgagcccggatccggcggcgaaagcggcgccggcggcggcggcggcgccggcggcggcggcgccggataccgcgagcgatgcggcggcggcggcggcgctgaccgcggcgaacgcgaaagcggcggcggaactgaccgcggcgaacgcggcggcggcggcggcggcgaccgcgcgcggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z