BBa_M36084 1 BBa_M36084 Histidine Tag and Stop Codon 2014-04-29T11:00:00Z 2015-05-08T01:14:02Z We know that histidine tags are a sequence of 6 Histidines and 1 stop codon Histidine Tag and Stop Codon Sequences false false _848_ 0 22183 9 Not in stock false Histidine tag must be before stop codon false Ashley Hammerbacher Celina Malav?? BBa_M36084_sequence 1 catcatcatcatcatcattag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z