BBa_K392003 1 BBa_K392003 yeast ADH1 terminator 2010-10-09T11:00:00Z 2015-05-08T01:12:20Z Registry parts BBa_K105027 (promoter) and BBa_J63003 (Kozak). Engineered 'cyc100 promoter' of <i>Saccharomyces cerevisiae</i> with Kozak sequence attached downstream. false false _528_ 0 6220 9 It's complicated true Assembled by 3A method. false Tadashi Nakamura, Shuhei Yasumoto, Takahiro Saka, Saya Kakuda BBa_K792001 1 MFa1-Kozak Kozak sequence from yeast &#945;-factor mating pheromone (MF&#945;1) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=MFA1 The Kozak sequence is the eukaryotic analog of the bacterial RBS, it is short sequence that includes the ATG, required for proficient initiation of translation. It is known that the 5???UTR sequence of the MF&#945;1 gene of yeast produces efficient initiation of translation. This part is that specific region of the MF&#945;1 gene. false false _1047_ 0 11811 9 Not in stock false None false Manuel Gim??nez annotation2197870 1 BamHI restriction site range2197870 1 1 6 annotation2197872 1 start range2197872 1 19 21 annotation2197871 1 rbs range2197871 1 7 21 BBa_M36086 1 BBa_M36086 Tenebrio Molitor Antifreeze Protein without Secretion Tag 2014-05-13T11:00:00Z 2015-05-08T01:14:03Z Gene of Interest from Uniprot Kozac sequence and Terminator from parts registry This is an actuator that will generate antifreeze proteins in yeast and hopefully, reduce ice growth within the yeast themselves. This part is specific because it does not have a yeast secretion tag on it because we do not know whether the signal peptide on the sequence will naturally be secreted (it is still an area of study within the field). false false _848_ 0 22183 9 Not in stock false We did not include the yeast secretion tag to make sure the antifreeze protein would go into the solution and exit the yeast cell. false Ashley Hammerbacher Celina Malav?? component2372945 1 BBa_M36083 component2372944 1 BBa_K792001 component2372947 1 BBa_K392003 component2372946 1 BBa_M36084 annotation2372944 1 BBa_K792001 range2372944 1 1 21 annotation2372946 1 BBa_M36084 range2372946 1 372 392 annotation2372945 1 BBa_M36083 range2372945 1 28 363 annotation2372947 1 BBa_K392003 range2372947 1 401 529 BBa_M36083 1 BBa_M36083 Tenebrio Molitor Antifreeze Protein 2014-04-29T11:00:00Z 2015-05-08T01:14:02Z Uniprot The Antifreeze Protein DNA false false _848_ 0 22183 9 Not in stock false We simply got the sequence off of Uniprot so that we could create the basic part to integrate into our actuator false Ashley Hammerbacher Celina Malav?? BBa_M36084 1 BBa_M36084 Histidine Tag and Stop Codon 2014-04-29T11:00:00Z 2015-05-08T01:14:02Z We know that histidine tags are a sequence of 6 Histidines and 1 stop codon Histidine Tag and Stop Codon Sequences false false _848_ 0 22183 9 Not in stock false Histidine tag must be before stop codon false Ashley Hammerbacher Celina Malav?? BBa_M36083_sequence 1 atggcgtttaaaacctgcggctttagcaaaaaatggctggtgattgcggtgattgtgatgtgcctgtgcaccgaatgctattgccagtgcaccggcggcgcggattgcaccagctgcaccggcgcgtgcaccggctgcggcaactgcccgaacgcggtgacctgcaccaacagccagcattgcgtgaaagcgaacacctgcaccggcagcaccgattgcaacaccgcgcagacctgcaccaacagcaaagattgctttgaagcgaacacctgcaccgatagcaccaactgctataaagcgaccgcgtgcaccaacagcagcggctgcccgggccat BBa_M36086_sequence 1 ggatccacgattaaaagaatgtactagatggcgtttaaaacctgcggctttagcaaaaaatggctggtgattgcggtgattgtgatgtgcctgtgcaccgaatgctattgccagtgcaccggcggcgcggattgcaccagctgcaccggcgcgtgcaccggctgcggcaactgcccgaacgcggtgacctgcaccaacagccagcattgcgtgaaagcgaacacctgcaccggcagcaccgattgcaacaccgcgcagacctgcaccaacagcaaagattgctttgaagcgaacacctgcaccgatagcaccaactgctataaagcgaccgcgtgcaccaacagcagcggctgcccgggccattactagagcatcatcatcatcatcattagtactagaggcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctattactagagcccgccgccaccatggag BBa_M36084_sequence 1 catcatcatcatcatcattag BBa_K392003_sequence 1 gcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctattactagagcccgccgccaccatggag BBa_K792001_sequence 1 ggatccacgattaaaagaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z