BBa_M36101 1 BBa_M36101 Promoter, HY5 regulated (2 HY5 binding sites) 2011-05-02T11:00:00Z 2015-05-08T01:14:03Z Modified J23100 promoter sequence. Constitutive promoter with two HY5 binding sites; one bs between -35 and -10, and one between -10 and 0. Binding sites will act as inhibitors for constitutive promoter function. false false _848_ 0 9548 9 Not in stock false Chose to insert 2 binding sites at specific locations in the promoter. false Andee Wallace, Taylor Nguyen, Chad Viergever annotation2118949 1 -10 range2118949 1 24 29 annotation2118950 1 HY5 range2118950 1 11 15 annotation2118948 1 -35 range2118948 1 1 6 annotation2118951 1 HY5 range2118951 1 30 35 BBa_M36101_sequence 1 ttgacggctacacgtgtcctaggtacagtcacgtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z