BBa_M36009 1 BBa_M36009 5' Bicistronic UTR (strong), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false please see long description. false Drew Endy BBa_M36108 1 BBa_M36108 Protein Generator, no promoter 2011-05-02T11:00:00Z 2015-05-08T01:14:03Z UTR, HY5 gene, terminator sequences No constitutive promoter. false false _848_ 0 9548 9 Not in stock false No promoter. Allows us to tag on a inducible promoter. false Andee Wallace, Taylor Nguyen, Chad Viergever component2118953 1 BBa_M36103 component2118954 1 BBa_M36010 component2118952 1 BBa_M36009 annotation2118954 1 BBa_M36010 range2118954 1 558 639 annotation2118952 1 BBa_M36009 range2118952 1 1 47 annotation2118953 1 BBa_M36103 range2118953 1 48 557 BBa_M36103 1 BBa_M36103 prokaryotic HY5 protein gene sequence 2011-05-02T11:00:00Z 2015-05-08T01:14:03Z Arabidopsis This part is the HY5 eukaryotic protein modified to be expressed in prokaryotes. The DNA sequence has been translated from the amino acids to be most compatible with prokaryotic DNA transcription. false false _848_ 0 9548 9 Not in stock false Correctly translating the HY5 amino acid sequence to DNA nucleotides that would be compatible with prokaryotic machinery. false Andee Wallace, Taylor Nguyen, Chad Viergever annotation2119125 1 start codon range2119125 1 1 3 annotation2119126 1 stop codon range2119126 1 508 510 BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36108_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaaatgcaggaacaggcgaccagcagcctggcggcgagcagcctgccgagcagcagcgaacgcagcagcagcagcgcgccgcatctggaaattaaagaaggcattgaaagcgatgaagaaattcgccgcgtgccggaatttgcgggcggcgaagcggtgggcaaagaaaccagcggccgcgaaagcggcagcgcgaccggccaggaacgcacccaggcgaccgtgggcgaaagccagcgcaaacgcggccgcaccccggcggaaaaagaaaacaaacgcctgaaacgcctgctgcgcaaccgcgtgagcgcgcagcaggcgcgcgaacgcaaaaaagcgtatctgagcgaactggaaaaccgcgtgaaagatctggaaaacaaaaacagcgaactggaagaacgcctgagcaccctgcagaacgaaaaccagatgctgcgccatattctgaaaaacaccaccggcaacaaacgcggcggcggcggcggcagcaacgcggatgcgagcctgtaatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36103_sequence 1 atgcaggaacaggcgaccagcagcctggcggcgagcagcctgccgagcagcagcgaacgcagcagcagcagcgcgccgcatctggaaattaaagaaggcattgaaagcgatgaagaaattcgccgcgtgccggaatttgcgggcggcgaagcggtgggcaaagaaaccagcggccgcgaaagcggcagcgcgaccggccaggaacgcacccaggcgaccgtgggcgaaagccagcgcaaacgcggccgcaccccggcggaaaaagaaaacaaacgcctgaaacgcctgctgcgcaaccgcgtgagcgcgcagcaggcgcgcgaacgcaaaaaagcgtatctgagcgaactggaaaaccgcgtgaaagatctggaaaacaaaaacagcgaactggaagaacgcctgagcaccctgcagaacgaaaaccagatgctgcgccatattctgaaaaacaccaccggcaacaaacgcggcggcggcggcggcagcaacgcggatgcgagcctgtaa BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36009_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z