BBa_M36120 1 BBa_M36120 5' Bicistronic UTR (strong) contains ATG start Codon. 2013-10-24T11:00:00Z 2015-05-08T01:14:03Z This is based on research done in the paper "Precise and reliable gene expression via standard transcription and translation initiation elements." Used in place of an RBS. This device contains two RBS's to provide more reliability in gene selection. Place upsteam of your gene of interest in an actuator design false false _848_ 0 19058 9 Not in stock false We had to consider the strength in the design of this sequence. Because our protein ( human myoglobin) is not shown to be toxic to e. coli, we want in to be expressed in high numbers and thus we chose a strong BCD. false Alaina Shumate annotation2370704 1 misc range2370704 1 1 88 BBa_M36120_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z