BBa_M36120 1 BBa_M36120 5' Bicistronic UTR (strong) contains ATG start Codon. 2013-10-24T11:00:00Z 2015-05-08T01:14:03Z This is based on research done in the paper "Precise and reliable gene expression via standard transcription and translation initiation elements." Used in place of an RBS. This device contains two RBS's to provide more reliability in gene selection. Place upsteam of your gene of interest in an actuator design false false _848_ 0 19058 9 Not in stock false We had to consider the strength in the design of this sequence. Because our protein ( human myoglobin) is not shown to be toxic to e. coli, we want in to be expressed in high numbers and thus we chose a strong BCD. false Alaina Shumate annotation2370704 1 misc range2370704 1 1 88 BBa_M36121 1 BBa_M36121 Human Myoglobin Gene 2013-10-25T11:00:00Z 2015-05-08T01:14:03Z This comes from the human genome. Specifically, it is found on chromosome 22. This gene produces the protein myoglobin in humans to transport oxygen to muscle and skeletal tissues. It has been optimized for expression in e. coli. false false _848_ 0 19058 9 Not in stock false We had to optimize the codons for e coli as the sequence we found is for humans. false Alaina Shumate BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898431 1 PolyA range1898431 1 1 9 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898428 1 B1006 range1898428 1 1 39 annotation1898429 1 modified thr terminator range1898429 1 10 31 BBa_M36122 1 BBa_M36122 Myoglobin Actuator 2013-10-25T11:00:00Z 2015-05-08T01:14:03Z The sequence for this part comes from the human genome. Specifically, this gene is located on chromosome 22. Our part takes as input the PoPS signal generated by a sensor and the output is human myoglobin protein. The codons have been optimized for expression in e. coli. The protein will be the protein that can bind a heme group and oxygen to serve its purpose as an oxygen carrier in muscular and skeletal tissues false false _848_ 0 19058 9 Not in stock false We chose to use a strong bicistronic device as the myoglobin protein has not been shown to be hazardous to e coli.The strength was picked based on information in "Precise and reliable gene expression via standard transcription and translation initiation elements". We also chose a strong terminator(BBa_B1006) because we have no need for a leaky terminator. We also had to optimize the codons for use in k12 e. coli. The strength of the terminator was determined based on the paper "Measurement and modeling of intrinsic transcription terminators" false Alaina Shumate component2370713 1 BBa_B1006 component2370707 1 BBa_M36120 component2370708 1 BBa_M36121 annotation2370708 1 BBa_M36121 range2370708 1 97 558 annotation2370707 1 BBa_M36120 range2370707 1 1 88 annotation2370713 1 BBa_B1006 range2370713 1 567 605 BBa_M36122_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatgtactagagggtctgtccgatggtgaatggcagctggtcctgaatgtttggggcaaagtggaggcggacattccggggcatggccaagaggtgttaatccgtctctttaagggacatccagagacattagagaaattcgataaatttaaacacctgaaaagcgaggacgaaatgaaggcttccgaagatcttaagaaacatggtgctactgtactgaccgcgctgggtgggattttgaaaaaaaaaggtcatcacgaggcggaaatcaaaccgctggcacaaagccacgctaccaaacataaaatcccggtcaaatacttagaatttattagtgaatgcatcatccaagtactgcagagcaaacaccccggcgactttggtgcagatgctcagggggccatgaacaaagcgttggagctcttccgtaaggacatggcgtcaaattacaaagaactgggcttccaaggctaatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_M36121_sequence 1 ggtctgtccgatggtgaatggcagctggtcctgaatgtttggggcaaagtggaggcggacattccggggcatggccaagaggtgttaatccgtctctttaagggacatccagagacattagagaaattcgataaatttaaacacctgaaaagcgaggacgaaatgaaggcttccgaagatcttaagaaacatggtgctactgtactgaccgcgctgggtgggattttgaaaaaaaaaggtcatcacgaggcggaaatcaaaccgctggcacaaagccacgctaccaaacataaaatcccggtcaaatacttagaatttattagtgaatgcatcatccaagtactgcagagcaaacaccccggcgactttggtgcagatgctcagggggccatgaacaaagcgttggagctcttccgtaaggacatggcgtcaaattacaaagaactgggcttccaaggctaa BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_M36120_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z