BBa_M36125 1 BBa_M36125 d1 (RNA scaffold) 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z Unmodified sequence from the paper "Organization of Intracellular Reactions with Rationally Designed RNA Assemblies" (Science 2011, Delebecque, et. al). Encodes for part of a 1 dimensional self-assembling RNA scaffold. false false _848_ 0 13699 9 Not in stock false The sequence comes directly from the Delebecque Science paper. To fold into a functional RNA scaffold, it should be paired with the appropriate aptamers and terminator. false Daniel McHugh BBa_M36125_sequence 1 taggcgcctagcctaatgtacattaagttatttttccggatgaatagaatatattc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z