BBa_M36126 1 BBa_M36126 Theophylline responsive ribozyme 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z M. N. Win, C. D. Smolke, ???A modular and extensible RNA-based gene-regulatory platform for engineering cellular function??? PNAS 36, 14283-14288 (2007). Ribozyme that self-cleaves in the presence of theophylline. false false _848_ 0 13699 9 Not in stock false The part includes two brief spacer sequences to ensure functionality over a range of transcript contexts. false Daniel McHugh BBa_M36126_sequence 1 aaacaaacaaagctgtcaccggatgtgctttccggtctgatgagtccgtgataccagcatcgtcttgatgcccttggcagcagtggacgaggacgaaatgtcgaaaaagaaaaataaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z