BBa_M36129 1 BBa_M36129 PP7 aptamer 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z C. J. Delebecque, A. B. Lindner, P. A. Silver, F. A. Aldaye, ???Organization of intracellular reactions with rationally designed RNA assemblies??? Science 333, 470-474 (2011). Encodes for an RNA sequence which functions as the binding domain for the PP7 bacteriophage coat protein. false false _848_ 0 13699 9 Not in stock false Can be used in the context of the one- and two-dimensional RNA scaffolds described in the Delebecque paper. false Daniel McHugh BBa_M36129_sequence 1 gaattccgaccagaagatatggcttcggttgggttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z