BBa_M36130 1 BBa_M36130 d2'' (RNA scaffold) 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z Delebecque et al, Science 2011 d2'' is the second part required for formation of the 2-dimensional RNA scaffold. The 2D RNA assembly D2 forms from d2' and d2'', each followed by a distinct PP7 and MS2 aptamer. The dormant tile d2' spontaneously generates the pro-tile d2-1, which interacts with d2'' to generate tile d2-2. d2-2 then self-assembles into the 2D RNA scaffold D2 with PP7 and MS2 binding domains. false false _848_ 0 13700 9 Not in stock false d2'' is only functional when used along with other parts required for the 2D RNA scaffold. false Vir Choksi BBa_M36130_sequence 1 tagttgttatggattcctgatttatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z