BBa_B0040 1 spacer Spacer.1 (generic) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Randomly generated and optimized for several parameters (see Design notes). Released HQ 2013 Generic spacer for ensuring a 70 bp distance between the end of the suffix of the BioBrick part containing the double terminator and the prefix of the BioBrick part containing the promoter of the new gene. Please, use the AlignX function of Vector NT to check for homology with the components in your plasmid before using this spacer.</P> false false _1_ 0 24 7 In stock false <P> <P><p>The size of the spacer was choosed to meet the minimum length of a sequence that can be queried using the BLAST search engine. However, subsequences of it can be used to design shorter spacers. The sequence was selected from many more sequences randomly generated using the <a href="http://www.lifesci.ucsb.edu/~maduro/random.htm">Random DNA Generator </a>engine; the GC% parameter used as input was 50%. The sequences were selected based on the following constraints listed in their order of importance: the absence of any putative promoter regions, a low degree of homology with the Elowitz plasmid (whose components are widely used in our designs), no homology with other <em>E.coli</em> sequences as shown by BLASTN search results and the presence of a number of TAA stop codons. The second constraint was the most stringent leading to the elimination of most sequences. </p> <p> DE made the following changes to the original sequence in order to add stop codons in the -3 frame and more in the +2 frame (note, not all of these stop codons are UAA. Thus, if used in an organism that inserts an amino acid @ UGA or UAG the obvious will occur):<br> T->A @ 85<br> T->A @ 42<br> C->T @ 79<br> A->T @ 64<br> A->T @ 31<br> T->A @ 34<br> C->A @ 37<br> Also, note that the above changes further reduce (the already very weak) homology to current NCBI-stored sequences.<br> </p> <P>In the process of selecting the best sequence it appeared that a good alternative sequence for a spacer would be: AGGTTCTGATATGTAACTGTGCCCAATGTCGTTAGTGACGCATACCTCTTAAGAGGCCACTGTCCTAACA. The sequence contains no putative promoters and shows moderate homology with the 5' end of the Ampicillin resistance gene. However a strong promoter sequence starts 12 bp downstream of this sequence, and therefore the sequence presented above was preferred. </p><P> The sequence is compatible (does not show significant homology) with the components in the Elowitz repressilator plasmid. true Vinay S. Mahajan, Brian Chow, Peter Carr annotation1721 1 Spacer-1 range1721 1 1 70 annotation7030 1 BBa_B0040 range7030 1 1 70 BBa_M36125 1 BBa_M36125 d1 (RNA scaffold) 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z Unmodified sequence from the paper "Organization of Intracellular Reactions with Rationally Designed RNA Assemblies" (Science 2011, Delebecque, et. al). Encodes for part of a 1 dimensional self-assembling RNA scaffold. false false _848_ 0 13699 9 Not in stock false The sequence comes directly from the Delebecque Science paper. To fold into a functional RNA scaffold, it should be paired with the appropriate aptamers and terminator. false Daniel McHugh BBa_M36135 1 BBa_M36135 Transcription terminator (apFAB388) 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z BIOFAB: part apFAB388, construct pFAB822 Released HQ 2013 Strong terminator from BIOFAB's terminator project false false _848_ 0 13700 9 In stock false Length similar to terminators used in Delebecque et al., Science 2011 false Vir Choksi BBa_M36133 1 BBa_M36133 1D RNA scaffold 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z C. J. Delebecque, A. B. Lindner, P. A. Silver, F. A. Aldaye, ???Organization of intracellular reactions with rationally designed RNA assemblies??? Science 333, 470-474 (2011). Self-assembles into a one-dimensional RNA scaffold with binding domains for MS2 and PP7 bacteriophage coat proteins. false false _848_ 0 13699 9 Not in stock false Due to the short length of the sequence, we added an additional spacer region after the terminator to allow for easier synthesis. This component should not be necessary for scaffold assembly. false Daniel McHugh component2176071 1 BBa_B0040 component2176067 1 BBa_M36127 component2176069 1 BBa_M36135 component2176066 1 BBa_M36125 component2176068 1 BBa_M36129 annotation2176066 1 BBa_M36125 range2176066 1 1 56 annotation2176068 1 BBa_M36129 range2176068 1 87 122 annotation2176069 1 BBa_M36135 range2176069 1 131 169 annotation2176071 1 BBa_B0040 range2176071 1 178 247 annotation2176067 1 BBa_M36127 range2176067 1 65 78 BBa_M36127 1 BBa_M36127 MS2 aptamer 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z C. J. Delebecque, A. B. Lindner, P. A. Silver, F. A. Aldaye, ???Organization of intracellular reactions with rationally designed RNA assemblies??? Science 333, 470-474 (2011). Encodes for an RNA sequence which functions as the binding domain for the MS2 bacteriophage coat protein. false false _848_ 0 13699 9 Not in stock false Can be used in the context of the one- and two- dimensional RNA scaffolds described in the Delebecque paper. false Daniel McHugh BBa_M36129 1 BBa_M36129 PP7 aptamer 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z C. J. Delebecque, A. B. Lindner, P. A. Silver, F. A. Aldaye, ???Organization of intracellular reactions with rationally designed RNA assemblies??? Science 333, 470-474 (2011). Encodes for an RNA sequence which functions as the binding domain for the PP7 bacteriophage coat protein. false false _848_ 0 13699 9 Not in stock false Can be used in the context of the one- and two-dimensional RNA scaffolds described in the Delebecque paper. false Daniel McHugh BBa_B0040_sequence 1 aggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaaca BBa_M36129_sequence 1 gaattccgaccagaagatatggcttcggttgggttc BBa_M36127_sequence 1 ccacagtcactggg BBa_M36135_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_M36133_sequence 1 taggcgcctagcctaatgtacattaagttatttttccggatgaatagaatatattctactagagccacagtcactgggtactagaggaattccgaccagaagatatggcttcggttgggttctactagagaaaaaaaaaccccgcccctgacagggcggggtttttttttactagagaggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaaca BBa_M36125_sequence 1 taggcgcctagcctaatgtacattaagttatttttccggatgaatagaatatattc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z