BBa_M36137 1 LacOp Del Lac Operon deleted CAP binding site 2015-10-21T11:00:00Z 2015-10-24T02:01:59Z E coli's natural genomic sequence (Ecogene) In order to modify the CAP binding site, we took the original sequence between the LacI and LacZ genes in E coli, and removed the 22 bp known to be the CAP binding site. In order to make our construct viable, we added some filler LacI sequence ahead of the intergene sequence. The idea behind removing the CAP binding site is to prevent the glucose inhibition in E coli, which stops lactose from being transcribed when glucose is present. false false _848_ 29064 29064 9 false We had to determine where the binding site is, and what endogenous sequences were necessary to include in our construct. For example, we noticed that we should not include a promoter and LacI as it may result in leakage. We also did not include LacZ because we will use CometGFP as part of our sensor. false Lea Jabbour, Kayla Clough BBa_M36137_sequence 1 gtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z