BBa_M36140 1 BBa_M36140 Production of GvpA 2015-10-23T11:00:00Z 2015-10-24T08:44:30Z iGem University of Gaslow Encodes for the production of a gas vesicle structural protein - GvpA. This, when coupled with GvpC in an optimal range of 23:1 ratio respectively, induces the growth of gas vesicles in the E. coli cell and thus increases buoyancy. This particular construct will be paired with a higher copy number in order to achieve the ratio mentioned above. It will also be paired with ampicillin resistance as to distinguish it from the separate GvpC plasmid also being transformed into the E. coli cells. false false _848_ 29088 29088 9 false high copy ORI number false Preethi Raghavan BBa_M36140_sequence 1 atggccgttgaaaaagtaaactcatcctccagtctggccgaagttatcgatcggatcttagataaaggcattgtgattgacgcttgggtacgggtttccctcgttggaatcgagcttctatccatagaagcaagaatcgtgatcgcttctgttgaaacctatctcaagtacgcagaagccgttggtttaaccgcacaggcggctgttccttcggtctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z