BBa_M36141 1 BBa_M36141 Production of GvpC 2015-10-23T11:00:00Z 2015-10-24T08:47:55Z iGem University of Gaslow Encodes for the production of a gas vesicle structural protein - GvpC. This, when coupled with GvpA in an optimal range of 1:23 respectively, induces the growth of gas vesicles in the E. coli cell and thus increases buoyancy. This particular construct will be paired with a lower copy number in order to reach the ratio mentioned above. It will also be paired with kanamycin resistance as to distinguish it from the separate GvpC plasmid also being transformed into the E. coli cells. false false _848_ 29088 29088 9 false low copy ORI number false Preethi Raghavan BBa_M36141_sequence 1 atggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgtgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z