BBa_M36145 1 BBa_M36145 Cold-inducible promoter 2012-06-05T11:00:00Z 2015-05-08T01:14:03Z http://ukpmc.ac.uk/articles/PMC3118111/pdf/1472-6750-11-51.pdf This promoter is up-regulated by lowering temperature (to 33 degree Celsius) and it was found in CHO cells. It has been discovered so far that the transcription factors for this promoter are NF-kB and SP1 which are endogenous to both CHO cells and HeLa cells. false false _848_ 0 13494 9 Not in stock false This sequence was found in CHO cells. In other types of cell, it is not guaranteed that the promoter will be up-regulated by the lowering of the temperature. false Jane Hae Soo Shin BBa_M36145_sequence 1 cctcatgccactcccaatccgggacagtcctggcagcagaggcgtggaaaactgagggggttgttggggtgtgttttgctagcctcaggcgccgggtggggctcggggcgggccggcactccttgggcgggcctcccggatgctagccgctataaggccagccggactgcgacacagtccatcccctgcaccactcctttggctcttcgctgtctacctgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z