BBa_M36146 1 BBa_M36146 Cold-inducible promoter for HeLa cells 2012-06-05T11:00:00Z 2015-05-08T01:14:03Z The sequence has been BLASTed to HeLa cells because it was originally found in CHO cells. http://ukpmc.ac.uk/articles/PMC3118111/pdf/1472-6750-11-51.pdf This promoter is up-regulated by the lowering of the temperature to 33 degree Celsius. It has been discovered that the transcription factors for this promoter are NF-kB and SP1, which are endogenous to HeLa cells. This promoter can be used in temperature-varying experiments. false false _848_ 0 13494 9 Not in stock false Since the promoter was found in CHO cells first, we used BLAST site to find a similar genetic sequence in HeLa cells. false Jane Hae Soo Shin BBa_M36146_sequence 1 cccccatcccgtcctaacccggaacagccccgggcaggaggcgtggaaagtcgagggggtaaaccgcgaatgtgcgttgtgtaagccacggcgcagggtggggcgcgggcgggacttgggcgggcggggtgggcttggccgagctggcctccggggcaccgaccgctataaggccagtcggactgcgacacagcccatcccctcgaccgctcgcgtcgcatttggccgcctccctaccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z