BBa_M36150 1 BBa_M36150 nifRLA promoter 2014-10-22T11:00:00Z 2015-05-08T01:14:03Z The nifRLA promoter sequence was determined from the nif gene cluster sequence for Azotobacter vinelandii. It is found upstream of the nifL repressor. The nifRLA operon regulates the expression of the nitrogen fixation (nif) genes. NifA activates transcription of nif genes by the alternative form of RNA-polymerase, s54-holoenzyme. NifL is a negative regulatory gene which inhibits the activation of other nif genes by nifA protein. NifR is a repressor binding site, between the promoter of the nifRLA operon and the nifL gene. false false _848_ 0 24150 9 Not in stock false We selected the genomic region upstream of the nifL repressor but following the nifR repressor binding site. This is the general region where the nifRLA promoter is found. false Monica Chin BBa_M36150_sequence 1 ctgctcggctaaactttgtcgatgcgcctttgtcgggcgcagtctttatgccggaagttgtgcatcaagcatgccagcgctcaaaatttgcacaggcgtatcgcgggagcccctctaaaattgacctggatcaacaaatagcttcggcacgccagccgcctatccacccggcggccccggttttgtaaggtttgtgacagctcgttactgagcctgccgcccggcttgtgcgctttcgcacagctagagggcgaccaccccgaaaatccatgtttcgaggtttttccgagcaattcggcgcacccgggcgattaaggtgcggcacaggatttgctaatcttctctcaggcccaacacgcccctccggcggacgcagccgcgctcgccggttttcttggatagacgaggcacagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z