BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898431 1 PolyA range1898431 1 1 9 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898428 1 B1006 range1898428 1 1 39 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_M36156 1 BBa_M36156 E.coli Cold Shock Promoter (CSP) 2014-10-22T11:00:00Z 2015-05-08T01:14:03Z This part came from the promoter region of the wild- type gyrA gene. The part behaves relatively similar to the heat shock promoter. In the presence of extreme low temperatures, the promoter sequence of is recognized by the protein CS7.4, which is a cold shock transcriptional activator of the genes gyrA and HNS. Once the CS7.4 binds to the cold shock operon, RNA polymerase is recruited to the cold shock promoter region to begin transcription. In sensor based projects, the cold shock promoter should be placed up stream of the gene that the user intends to transcribe. false false _848_ 0 24179 9 Not in stock false This gene is naturally found in E.coli and so is not a sensor that we needed to modify. This part has never been tested but is proven to initiate transcription in E.coli when a cold shock occurs. false Sohaib Shaikh BBa_K338001 1 HSP Heat Shock Promoter (HSP) 2010-10-23T11:00:00Z 2015-05-08T01:12:07Z Modified BBa_K112400 This is a modified K112400 heat shock promoter in BBa standard. false false _454_ 0 6189 9 It's complicated true None false 2010 Caltech iGEM Team BBa_M36157 1 BBa_M36157 MeffBlue, Blue Chromoprotein 2014-10-22T11:00:00Z 2015-05-08T01:14:03Z The source for this part is the Part BBa_K1033902, which is the MeffBlue, Blue Chromoprotein. This chromoprotein from Montipora efflorescens, meffBlue (also known as Rtms5), naturally exhibits strong color when expressed. The protein has blue color visible to the naked eye. Compared to many other chromoproteins, the color development is slower requiring 24-64 incubation for the color to be readily observed. It is visible on both LB or on agar plates. false false _848_ 0 24179 9 Not in stock false In designing this part we modified several of the DNA base pairs in the Part BBa_K1033902 in order to avoid palindromes that were over 10 bp in length. The base pairs were modified in such a way to maintain the same Amino Acid sequence as Part BBa_K1033902. false Sohaib Shaikh BBa_M36158 1 BBa_M36158 E.coli Temperature Shock Sensor/Actuator 2014-10-22T11:00:00Z 2015-05-08T01:14:03Z See subparts below for part sources. The structure of this part is the cold shock promoter (BBa_M36156), followed by a ribosome binding site (BBa_B0034), meffBlue (BBa_M361567), a transcriptional terminator (BBa_B1006), and finally a heat shock promoter (BBa_K338001). This temperature shock sensor/actuator produces Comet, a green fluorescent protein, or meffBlue, a blue chromoprotein, under heat shock or cold shock, respectively. MeffBlue, part BBa_B0034, is placed downstream of the cold shock promoter, part BBa_M36156, to induce the synthesis of this blue protein under cold conditions. Although not included in this DNA design, if placed carefully, this DNA design can be inserted in the DNA backbone of E.coli, that already contains Comet, upstream of which contains a ribosome binding site such that transcription of Comet can be activated by the heat shock promoter, part BBa_K338001. false false _848_ 0 24179 9 Not in stock true Since we wanted to design E.coli that would produce color under cold shock and heat shock, the this part was designed such that after the heat shock promoter, the gene for Comet would be placed. This is only achievable if the DNA backbone of E.coli contains Comet. false Sohaib Shaikh and Alfonso Ocampo component2429051 1 BBa_B1006 component2429052 1 BBa_K338001 component2429043 1 BBa_M36156 component2429046 1 BBa_M36157 component2429045 1 BBa_B0034 annotation2429052 1 BBa_K338001 range2429052 1 838 935 annotation2429051 1 BBa_B1006 range2429051 1 791 829 annotation2429043 1 BBa_M36156 range2429043 1 1 87 annotation2429045 1 BBa_B0034 range2429045 1 96 107 annotation2429046 1 BBa_M36157 range2429046 1 114 782 BBa_M36158_sequence 1 agcgtataggtttacctcaaactgcgcggctgtgttataatttgcgacctttgaatcgggatacagtagagggatagcggttagatgtactagagaaagaggagaaatactagatgtccgtgattgcaacccaaatgacctacaaagtttacatgagcggtaccgttaatggccactactttgaagtcgagggcgacggtaagggtcgtccgtatgagggtgagcagaccgttaagttgacggttacgaaaggtggcccgctgccgttcgcttgggatatcctgagcccacaatgtcaatacggtagcattccttttaccaagtatccggaagatatcccggactatgtgaagcaaagcttcccggaaggcttcacttgggagcgtattatgaactttgaagatggcgcggtctgcacggtgtccaatgacagcagcatccagggtaattgctttacctatcacgtgaagttctcgggtctgaacttcccgccaaatggcccggttatgcagaaaaagacccagggttgggagccgcatagcgaacgtctgttcgcgcgtggtggcatgttgatcggtaacaactttatggcactgaaactggagggtggcggccactacctgtgtgagttcaagaccacgtataaggccaagaaaccggtgaaaatgccgggttaccactacgtcgatcgcaaactggacgtaactaatcataacaaagactacacgagcgtcgaacagtgcgagatttctatcgcgcgcaaaccggttgtggcgtaatgatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttttactagagccgaggtccttgttgcgaagattgatgacaatgtgagtgcttcccttgaaaccctgaaactgatccccataataagcgaagttagcgagatgaatgcg BBa_M36156_sequence 1 agcgtataggtttacctcaaactgcgcggctgtgttataatttgcgacctttgaatcgggatacagtagagggatagcggttagatg BBa_B0034_sequence 1 aaagaggagaaa BBa_M36157_sequence 1 atgtccgtgattgcaacccaaatgacctacaaagtttacatgagcggtaccgttaatggccactactttgaagtcgagggcgacggtaagggtcgtccgtatgagggtgagcagaccgttaagttgacggttacgaaaggtggcccgctgccgttcgcttgggatatcctgagcccacaatgtcaatacggtagcattccttttaccaagtatccggaagatatcccggactatgtgaagcaaagcttcccggaaggcttcacttgggagcgtattatgaactttgaagatggcgcggtctgcacggtgtccaatgacagcagcatccagggtaattgctttacctatcacgtgaagttctcgggtctgaacttcccgccaaatggcccggttatgcagaaaaagacccagggttgggagccgcatagcgaacgtctgttcgcgcgtggtggcatgttgatcggtaacaactttatggcactgaaactggagggtggcggccactacctgtgtgagttcaagaccacgtataaggccaagaaaccggtgaaaatgccgggttaccactacgtcgatcgcaaactggacgtaactaatcataacaaagactacacgagcgtcgaacagtgcgagatttctatcgcgcgcaaaccggttgtggcgtaatga BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K338001_sequence 1 ccgaggtccttgttgcgaagattgatgacaatgtgagtgcttcccttgaaaccctgaaactgatccccataataagcgaagttagcgagatgaatgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z