BBa_M36160 1 BBa_M36160 T7 17.5 protein (holin) 2012-06-03T11:00:00Z 2015-05-08T01:14:03Z http://www.ncbi.nlm.nih.gov/nuccore/NC_001604.1?report=genbank&from=36344&to=36547 Coding sequence for 17.5 protein in T7 phage. The 17.5 protein functions as a holin: in gram-negative bacteria, the holin degrades the inner peptidoglycan cell wall. For complete lysis to occur, an endolysin protein is also required (in T7 phage, this is the 3.5 protein). This sequence should be preceded by a promoter. false false _848_ 0 13546 9 Not in stock false Note: this sequence begins with a GTG start codon when expressed naturally; in our design, we opted to change the start codon to ATG to optimize for E. coli false Eric Kofman, Matt Kandath BBa_M36160_sequence 1 ctatcattagactttaacaacgaattgattaaggctgctccaattgttgggacgggtgtagcagatgttagtgctcgactgttctttgggttaagccttaacgaatggttctacgttgctgctatcgcctacacagtggttcagattggtgccaaggtagtcgataagatgattgactggaagaaagccaataaggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z