BBa_M36162 1 ROSES RhNUDX1 - Rose Scent (Geraniol) Precursor Catalyzing Gene 2015-10-21T11:00:00Z 2015-12-03T05:10:55Z Sequence found by converting amino acid sequence of RhNUDX1 protein native to Rosa x hybrida roses (Papa Meilland breed). Coding sequence for the enzyme RhNUDX1. This protein catalyzes the removal of a phosphate group from geranyl diphosphate to produce geranyl monophosphate (phosphatase is required to convert geranyl monophospate to geraniol, the actual scented compound). false false _848_ 29079 29079 9 true This DNA sequence was created by converting the amino acid sequence of RhNUDX1 using the Genedesigner 2.0. We used the IDT Codon Optimizer tool to improve compatibility with E. coli, altering base pairs to preserve amino acid sequence. To remove restriction site problems with BsaI, we modified nucleotide 12 (G -> A) and nucleotide 33 (G -> A). false Luke Murphy, Julia Duncan, Bruce Tiu annotation2478219 1 Replace G with A range2478219 1 33 33 annotation2478428 1 Added TAG range2478428 1 451 453 annotation2478218 1 Replace G with A range2478218 1 12 12 BBa_M36162_sequence 1 atgggcaacgaaaccgtagtggtcgcggagacagccggcagcatcaaagtagcagtggtggtctgtttactgcgcggtcagaacgtcttactgggccgccgccgtagctcactgggcgattccaccttctcgttaccttcggggcacttggaattcggagaatcgtttgaagaatgcgcggcgcgcgaactgaaagaggaaaccgacctggatattggaaaaattgaactgctgacggttacaaataacctgtttctggatgaagcaaaaccctcacagtatgtggcagtgttcatgcgggctgtgctggcggatccgcggcaagaaccacaaaatattgaaccggaattttgcgacggttgggggtggtatgaatgggacaatctcccgaagccgttgttttggccgctggataatgtcgtccaggatggcttcaacccgtttcctacgtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z