BBa_M36177 1 BBa_M36177 pH sensor 2015-10-22T11:00:00Z 2015-12-03T02:25:54Z rcFB transcriptional regulator in Lactococcus lactis genome. pH sensor, active within range 5.5-7.0. Our part is based on the acid inducible promoter region of a rcFB gene (procuding rcFB protein) in Lactococcus lactis. Ou assumptions are as follows: (1) generally Lactococcus lactis genes will work in E. coli, (2) all transcription factors specific to this rcFB gene are endogenous to E. coli, (3) there is no additional layer of feedback controlling the rcFB gene, (4) the rcFB gene is more responsive to lactic acid/lactate than carbohydrates (to which it also reacts), (5) base level of transcription is low in comparison to when gene is turned on. false false _848_ 29085 29099 9 false We were limited by the following restrictions (1) 200-1500 bp size limit, (2) no Bbsl, Bsal, or BsmBI sites, (3) no repeats of length greater than 5 base pairs. false Majed Magzoub, Guhan Venkataraman, Joe Carpenter annotation2478349 1 promoter range2478349 1 1 431 BBa_M36177_sequence 1 tattggctttgttgtcttattaattgctggtggagccttcggtcttggttacggtggtgttgcaccatttggtcaagcaattgctattcggaggaggggagaatgattcaagtaaagaccgtatcggtgttgcaacttctaccttctttggatttttagatttaggtgttggtggaggacctattgttcttgggattggggggagcaattattccaatgcttggaaatggtatgcttggtttcagaaatttgtatctttacagtgctcccgcagttgtaattgtttggattatagggaaatactatctcattcatggtaaacatcaaaaatcaagttctaaagtttgattttaatgatttacataaaaaatgatataatgaaatggctagcagccttatataggcgaataaatgaacaaattagcgagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z