BBa_M36189 1 BBa_M36189 Spacer with many stop sequences 2012-05-02T11:00:00Z 2015-05-08T01:14:03Z TAATAAGGTAAGTAATTAGGTAACAATAACGTTGTGCTAAGTAAGCGTAAATAAAATGTTCTAAAATAACGTTAAAGTGTAAGTAAGGAAGTAATAAAATATTTAA This part is spacer of 106bp. It is intended to be used as a non-linking spacer between to coding regions. false false _848_ 0 13233 9 No part sequence false This spacer part should not link two proteins of interest, it should instead allow for the addition of an RBS on the end of this part which would then allow for clean translation of a protein. false Aaron Thayer igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z