BBa_M36204 1 BD14 Bicistronic RBS (BD14) 2011-12-06T12:00:00Z 2015-05-08T01:14:03Z Andrew Endy's design. More information found at BIOFAB.org. This is a bicistronic RBS, consisting of a constitutive RBS, followed by a leader sequence that includes the second RBS. The first constitutive RBS uses ribosomes to physically occupy the second RBS, preventing the second RBS from binding to genes of interest downstream. This ensures a more consistent, stable expression level of your gene of interest. This bicistronic RBS was designed by Andrew Endy. More information can be found at BIOFAB.org. false false _848_ 0 11067 9 Not in stock false N/A false Steven Lee BBa_M36204_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcggtggagggtttcta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z