BBa_M36236 1 BBa_M36236 5' Bicistronic UTR (no ATG) 2011-12-10T12:00:00Z 2015-05-08T01:14:04Z BIOFAB part id: apFAB563 This is a 5' UTR that uses bicistronic junction architecture to tightly control translation. It contains two ribosome binding sites: one to control the gene of interest, and another to synthesize a short leader protein. The latter cistron's translation prevents the former RBS from forming a secondary structure with the gene of interest. NOTE: The part BBa_M36282 is identical to this one and was submitted by a member of the same group. It is recommended that the instructors of this group deprecate one of the duplicates. false true _848_ 0 11064 9 Not in stock false Obtained from BIOFAB.org false Lawrence Xing BBa_M36236_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttcta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z