BBa_M36237 1 BBa_M36237 5' Bicistronic UTR (no ATG) 2011-12-10T12:00:00Z 2015-05-08T01:14:04Z BIOFAB part id: apFAB546 This is a 5' UTR that uses bicistronic junction architecture to tightly control translation. It contains two ribosome binding sites: one to control the gene of interest, and another to synthesize a short leader protein. The latter cistron's translation prevents the former RBS from forming a secondary structure with the gene of interest. false false _848_ 0 11064 9 Not in stock false Obtained from BIOFAB.org false Lawrence Xing BBa_M36237_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcacaggagactttcta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z